Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 70042609 70051395 enh44314

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 70050854 rs142538146 ACCCTGTGGCACTGCTCAGAG A 4509167

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results