Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69453520 69454472 vista10774

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69453715 rs3842249 CCGCCGGGCCCCAAATTCCAG C 2076378
chr11 69453715 rs538994010 CCGCCGGGCCCCAAATTCCAG C 2076379

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 69455855 69469242 + CCND1 ENSG00000110092.3 69455855 0.8 1.0 2137 11184


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results