Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50009905 50019755 enh51811

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50017836 rs148660852 T TCA,TCACACACA,TCACACACACACA 3525151
chr14 50017836 rs58389653 T TCA,TCACACACACACACACACACA 3525152
chr14 50017836 rs767461415 T TCA 3525153

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results