Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50598205 50605215 enh3179

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50598264 rs549000117 GCTCAAACATATCTAGTTTGAGATA G 3528877

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results