Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50782825 50786975 enh108595

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50783129 rs570494057 A ATTTATCTTTGTTTTTATTGCATTT 3529445

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results