Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 51704745 51710375 enh3186

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 51706760 rs28372741 TTCCTTCCCCCACAATATTGGGACACCC T 3534306
chr14 51706760 rs6145340 TTCCTTCCCCCACAATATTGGGACACCC T 3534307

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 51706880 51722759 + TMX1 ENSG00000139921.8 51706880 0.81 0.99 116 13308


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results