| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 51704745 | 51710375 | enh3186 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 51706760 | rs28372741 | TTCCTTCCCCCACAATATTGGGACACCC | T | 3534306 | |
| chr14 | 51706760 | rs6145340 | TTCCTTCCCCCACAATATTGGGACACCC | T | 3534307 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr14 | 51706880 | 51722759 | + | TMX1 | ENSG00000139921.8 | 51706880 | 0.81 | 0.99 | 116 | 13308 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|