Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 52581685 52587995 enh15612

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 52583835 rs547839995 AACTTTTTATTATGGAAGAGTTCAAGCAAAT A 3540738

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results