Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 53647444 53656415 enh75468

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 53649693 rs548320238 GGCAGGAGAGTTGGTAATATTCTAAAA G 3546153

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results