Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 59640058 59644631 enh60499

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 59642777 rs566472262 ATACATATATATACATATATG A 3578606

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results