Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 61660825 61666395 enh75499

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 61664329 rs528937573 C CATTAGTCCATTCATCCATGAATGA 3587843

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results