Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 62302405 62310155 enh75501

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 62308184 rs570053321 TTAAAAGGTTTTTAAAAAATAATAGC T 3593947

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results