Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 62480005 62487655 enh15664

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 62482189 rs141295945 C CATAAGGCAAAAAGACAGCATCCTGAG 3595056
chr14 62482189 rs368411910 C CATAAGGCAAAAAGACAGCATCCTGAG 3595057

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results