Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64572965 64583059 enh15678

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64576828 rs529875291 CATAAGCAGTGGGGGAGATATGCAGGT C 3603864

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results