Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65882585 65907195 enh3292

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65896744 rs34753196 GT G 3612591
chr14 65896744 rs796875965 GT G 3612592
chr14 65896746 rs529083429 T TTTTTTTTTGAGACAGGGTATCTG 3612593
chr14 65896751 rs561626205 T G 3612594

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results