Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65882585 65907195 enh3292

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65902352 rs145597484 T TTGCTGGATGATATGGTAAGCATA 3612674

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results