Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 67630245 67635315 enh75518

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 67632165 rs33961240 ATATCAAAGCACATTCCAAATCC A 3618075
chr14 67632165 rs3830996 ATATCAAAGCACATTCCAAATCC A 3618076

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results