Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 72263405 72273995 enh31020

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 72269828 rs201357064 CTTATTTATTTATTTAT C 3647991
chr14 72269828 rs549504493 CTTATTTATTTATTTATTTAT C 3647992
chr14 72269837 rs543880548 T A 3647993

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results