Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 74712211 74720475 enh60512

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74719201 rs139164446 CTCCTGCCTCATCCTCCTGAG C 3659408
chr14 74719201 rs77697300 CTCCTGCCTCATCCTCCTGAG C 3659409

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results