| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 89531745 | 89535895 | enh107610 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 89534729 | rs531713810 | AAATTTATTAGAAAAACAAGTTTTTCTAATAAATTTATTAGTTTTTCTAAT | A | 3715245 | |
| chr14 | 89534733 | rs7147786 | T | G | 3715246 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|