Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 92069965 92074290 enh15864

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 92073293 rs71120175 C CTAGTGACAGACATATCAAGG 3732393

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results