Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 92952185 92957915 enh15871

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 92954309 rs373712991 TTCCTCCTCCTGCTCCTCCTCCTCC T 3735858
chr14 92954309 rs570795339 TTCCTCCTCCTGCTCCTCCTCCTCC T 3735859

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results