Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 93723420 93727775 enh15890

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 93724252 rs576337119 TTACTGCATAAAAGTAGACCCTTTGA T 3742430

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results