Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 94448409 94453535 enh44063

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 94451151 rs539020082 GGGAAAGGGGAGGATGCTCTT G 3745990
chr14 94451154 rs113305869 A C,G 3745991

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results