Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 95520865 95525015 enh96551

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95521273 rs149558135 TGGGGTGTCTCCTCCAAGACTGA T 3752779
chr14 95521273 rs377313775 TGGGGTGTCTCCTCCAAGACTGA T 3752780

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results