Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 96097005 96107685 enh15904

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 96098944 rs374799631 AGGGCAATTCCTGGGAAGGGACCCAGC A 3758203

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results