Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 99271025 99277075 enh96555

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 99274869 rs557175046 CCTCTGTCCCTCCCTTCTTCCCTGT C 3776926
chr14 99274874 rs547826248 G C 3776927

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results