Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100804185 100808335 enh47812

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100807092 rs74085070 C A,T 3789570
chr14 100807094 rs527682653 GGCCCTGTTCTGCCCCACAAGAA G 3789571

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results