EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr14:100950797-100950817]
Chromosome characteristics of RREB1[chr14:100950797-100950817]
Back to top
Enhancers possibly regulated by RREB1[chr14:100950797-100950817]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100950485 100955340 enh15942
Muscle (Myotube) Astrocyte Placenta Muscle (Myoblast)
SNP sites on RREB1[chr14:100950797-100950817]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100950800 rs575039124 GGTGTGTGTGTGTGTGTGTGTGC G 3790579
chr14 100950801 rs544132841 GT G 3790580
chr14 100950803 rs557071942 GT G 3790581
chr14 100950814 rs11625843 T C 3790582
Genes possibly regulated by RREB1[chr14:100950797-100950817]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr14:100950797-100950817]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results