Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101612703 101619855 enh80931

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101615215 rs543028070 CTCACAGGTGCATATCACCTGTGGGA C 3795899

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results