Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101638825 101643495 enh101412

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101641517 rs142303432 G GGGTGTGGGCAGGAGGCCAGA 3796029
chr14 101641517 rs71116819 G GGGTGTGGGCAGGAGGCCAGA 3796030

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results