Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 102059885 102065295 enh47814

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 102060017 rs143032633 A ATTGGGAAAGGGCTCTGCAGCAGGTT 3799009

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results