Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 102764065 102768215 enh80933

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 102764927 rs141589302 C T 3803536
chr14 102764928 rs190848395 G A 3803537
chr14 102764937 rs377416509 AGCTCTCTGTAAAACAGACCAATTG A 3803538
chr14 102764937 rs544367173 AGCTCTCTGTAAAACAGACCAATTG A 3803539

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results