Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103181526 103185966 enh3468

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103182932 rs142860820 T TATTGAAGAAACTGTCCTTTATCCTTTGCA 3807161
chr14 103182932 rs60493851 T TATTGAAGAAACTGTCCTTTATCCTTTGCA 3807162

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results