| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 103181526 | 103185966 | enh3468 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 103182932 | rs142860820 | T | TATTGAAGAAACTGTCCTTTATCCTTTGCA | 3807161 | |
| chr14 | 103182932 | rs60493851 | T | TATTGAAGAAACTGTCCTTTATCCTTTGCA | 3807162 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|