| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 103203085 | 103207235 | enh15967 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 103206012 | rs189430409 | G | C | 3807250 | |
| chr14 | 103206015 | rs370034963 | T | TTGTCGGTGATTGATCTGACTTCC | 3807251 | |
| chr14 | 103206015 | rs561161341 | T | TTGTCGGTGATTGATCTGACTTCC,TTTGTCGGTGATTGATCTGACTTCC | 3807252 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|