EnhancerDB
  1. Home
  2. TFBS
  3. DUX4[chr16:80755079-80755090]
Chromosome characteristics of DUX4[chr16:80755079-80755090]
Back to top
Enhancers possibly regulated by DUX4[chr16:80755079-80755090]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 80749485 80756375 enh16823
Prostate (PC-3) Cervix (HeLa-S3) Placenta Pancreas Spleen Blood (T-cell) Epithelial (MCF-7)
SNP sites on DUX4[chr16:80755079-80755090]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 80755087 rs375013611 ATCACTGTCATGTGCTAGCTG A 4576331
Genes possibly regulated by DUX4[chr16:80755079-80755090]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by DUX4[chr16:80755079-80755090]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results