EnhancerDB
  1. Home
  2. TFBS
  3. CTCF[chr16:80888143-80888162]
Chromosome characteristics of CTCF[chr16:80888143-80888162]
Back to top
Enhancers possibly regulated by CTCF[chr16:80888143-80888162]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 80876425 80888375 enh16826
Placenta Cervix (HeLa-S3)
SNP sites on CTCF[chr16:80888143-80888162]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 80888151 rs375915259 CCCTTCTGGTATGCACAAGA C 4577244
chr16 80888151 rs560267527 CCCTTCTGGTATGCACAAGA C 4577245
chr16 80888159 rs547922269 G A 4577246
Genes possibly regulated by CTCF[chr16:80888143-80888162]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CTCF[chr16:80888143-80888162]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results