Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105114765 105118915 enh47820

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105117053 rs190193569 C T 3824095
chr14 105117055 rs199848383 C CGGGGCTCCTCTGGCTGGCT 3824096

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results