Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 106086405 106092955 enh15995

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 106089495 rs587615781 C CCCGTCCTGCGCCTCCGCACAGCTCT 3831904
chr14 106089498 rs147157477 G A 3831905

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results