EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr14:106175032-106175053]
Chromosome characteristics of ZNF263[chr14:106175032-106175053]
Back to top
Enhancers possibly regulated by ZNF263[chr14:106175032-106175053]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 106160679 106180735 enh3492
Blood (OCI-LY7) Blood (GM12878) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422)
SNP sites on ZNF263[chr14:106175032-106175053]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 106175037 rs58621233 C CA,CATGCCA,CATGCCATG,CATGCTATG,CCATG 3832725
chr14 106175040 rs59809572 C CACAGGAGGACAG,CATGTCACCAGGAGGACAG,CCAAGGAGGACAG,CCATGTCCCCAGGAGGACAG,CCCAGGAGGACAG,CCCGGGAGGACAG 3832726
chr14 106175044 rs57258431 A C,G 3832727
chr14 106175045 rs587739978 T TC,TG,TGTC,TGTG 3832728
chr14 106175046 rs57254189 A C,G 3832729
Genes possibly regulated by ZNF263[chr14:106175032-106175053]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr14:106175032-106175053]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results