Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 106194020 106200975 enh3493

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 106197949 rs374034492 T TCCCCCATGCGTGGCAGGCATTGTTGTGTGG,TGTGG 3832921
chr14 106197949 rs71132019 T TCCCCCATGCGTGGCAGGCATTGTTGTGTGG 3832922

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results