Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 106443529 106458215 enh47823

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 106448579 rs527675859 T TCACTCGGGAGACCACCTTATTTAAC 3834017

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results