| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 81255085 | 81259235 | enh64983 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 81258663 | rs568814028 | T | TTTGTTTAGCTTTGCTG | 4580740 | |
| chr16 | 81258666 | rs60663141 | C | CTAG | 4580741 | |
| chr16 | 81258666 | rs71808769 | C | CTAG,CTTAGCTTTGCTGTTCTAG,CTTTAGCTTTGCTGTTCTAG | 4580742 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|