Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 82699187 82705803 enh64988

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 82701158 rs11275806 AAGGAAGCCCTTGGCAAGGG A 4594827

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results