Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85291348 85301121 enh60632

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85292872 rs11274739 GCCCTGTGCTCCACCCTGGCCCA G 4619484
chr16 85292872 rs145924144 GCCCTGTGCTCCACCCTGGCCCA G 4619485

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results