Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 45219385 45233395 enh2303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 45232462 rs573121144 A AAATTGGTGTATTATTACAACGTGGATAAAT 2594957

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results