Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 46478885 46485815 enh14671

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 46483982 rs367758430 TTTGGGCTTGTATGCTGTTTGTAC T 2601113
chr12 46483982 rs372423318 TTTGGGCTTGTATGCTGTTTGTAC T 2601114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results