Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 50782245 50789055 enh14705

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 50787132 rs542345004 C CCAACATGGTGAAACCTTCACCTT 2626275

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 50720013 50790405 - FAM186A ENSG00000185958.5 50790405 0.8 0.9 3261 12051
chr12 50786166 50873787 + LARP4 ENSG00000161813.16 50786166 0.69 0.98 966 12052


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results