Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85710525 85714675 enh52384

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85711024 rs557174208 GCATTGTCACTCATGCTCAATA G 4627314

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results