Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52728925 52734823 enh89658

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52731631 rs571130406 TATATAAGATGAATAGGTCTGAGAG T 2638190

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results