Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 54760525 54766295 enh110767

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 54765973 rs541160401 TAGAAACATCAGAACCGGAGAGGGA T 2652064
chr12 54765973 rs79950809 T C 2652065

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results